Financial pressures felt over the last few years has led to a new set of challenges around total cost of ownership (TCO). Video services are now tasked with finding ways to reduce spending and ...
The camera rumors are flying thick and fast! Here are the most credible rumblings and reports about what's coming next ...
Context graphs, graph memory, and ontologies for AI are converging. What does this mean for enterprise AI in 2026?
Allegro DVT announced its contribution to the European CHASSIS program's implementation of the Automotive Base Die chiplet. The 5nm chiplet is set to revolutionize the automotive semiconductor ...
The OCI MSA settled the architecture for optical scale-up. How fast bandwidth scales is a manufacturing question, not an ...
Atomic defects can tune carbon quantum dots across UV to near-infrared light, guiding cleaner design of sensors, bioimaging ...
Money has always been political. What is changing is the speed at which that politics is now playing out in digital form.
Carbon quantum dots (CQDs) are tiny carbon-based nanomaterials that have attracted increasing attention as environmentally ...
Google search market share has been eroding for two years, but this week brought a sharper signal: Gemini co-lead Noam ...
A reverse primer designed from EST aa306952 (5′–CGTAACACTCCATGGAAATCAGC–3′) and a forward primer designed from the ORF upstream to EST aa306952 (5′–ATGAAGGATGTTATGTCAGCTCTGT–3′) were used to amplified ...
Summary: Researchers resolved a long-standing debate regarding “adaptive efficiency”, how the human brain allocates finite neural energy when processing predictable versus unexpected events. The study ...
SINGAPORE – Around December 2025, administrative assistant Luke (not his real name), who is single, was told that there were photos of him online with a woman claiming to be his fiancee and the baby ...