The self-improving AI agent built by Nous Research. It's the only agent with a built-in learning loop — it creates skills from experience, improves them during use, nudges itself to persist knowledge, ...
We designed single-guide RNA (sgRNA) for 3 target sequences in the human TFE3 gene (GGCGATTCAACATTAACGACAGG, GCGACGCTCAACTTTGGAGAGGG, TCGCCTGCGACGCTCAACTTTGG) and 4 target sequences in the human TFEB ...
Abstract: In recent years, unmanned aerial vehicles (UAVs) have gained significant popularity and are used for many applications, from entertainment to surveillance and the modern battlefield. As ...
Father’s Day has a reputation problem. Too often, it ends in a generic card or a mug, on even a novelty item nobody asked for. This year, we’re suggesting a different approach. Whether your dad ...
Technical literacy really isn’t about writing code. It’s the ability to read a system the way an MBA reads a P&L: what it can ...
There was an error while loading. Please reload this page.
Spread the love“`html In today’s visually driven world, the ability to remove background from image files is an essential skill, whether you’re a graphic designer, a marketer, or just someone wanting ...
Spread the love“`html In the world of digital design, the ability to make image transparent is an invaluable skill. Whether you’re enhancing a graphic for a web page, streamlining a presentation, or ...
KSL is Utah's #1 source for news, sports, weather, and classifieds. Get the latest breaking news Utah cares about - today's news, current headlines, and more.
A unique psychology seminar course generated a decade’s worth of career advice for first time job seekers, including the importance of relationship building and flexibility.